Month: November 2022

Novel sustainable strategies to control Plasmopara viticola in grapevine unveil new insights on priming responses and arthropods ecology was written by Giudice, Gaetano;Moffa, Loredana;Niero, Marina;Duso, Carlo;Sandrini, Marco;Vazzoler, Loris Francesco;Luison, Massimiliano;Pasini, Enrico;Chitarra, Walter;Nerva, Luca. And the article was included in Pest Management Science in 2022.Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Reduction of fungicide consumption in agriculture is globally recognized as a priority. Government authorities are fostering research to achieve a reduction of risks associated with conventional pesticides and promoting the development of sustainable alternatives. To address these issues, in the present study, alternative protocols for the control of downy mildew infection in grapevine were compared to the standard protocol. In the first protocol, only resistance inducers were used, comprising a single formulation with Acibenzolar S-Me, laminarin and disodium-phosphonate. The second and third protocols followed the standard protocol but substituted phosphonates with phosphorus pentoxide and Ecklonia maxima extract The results showed that at veraison downy mildew incidence and severity in all tested protocols were significantly reduced compared to nontreated controls on both canopy and bunches. Expression anal. of key genes involved in plant stress response, indicated that the two protocols for phosphites substitution induced a remodulation of salicylic acid (SA) and jasmonic acid (JA), with pos. impact on yields. Anal. of the first protocol revealed that the primed state induced a short delay in bunch ripening, with a shift of carbohydrate metabolism to boost the plant defences, involving an upregulation of defense related-gene, SAR response and a decreased ROS detoxification. Addnl., anal. on the arthropods populations, in parallel with the pos. results achieved using alternatives to conventional fungicides, were enriched by those showing the potential of naturally occurring predators of spider mites. This study provides practical solutions to reduce the environmental impact of treatments for the control downy mildew in viticulture. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Similar to water, an alcohol can be pictured as having an sp3 hybridized tetrahedral oxygen atom with nonbonding pairs of electrons occupying two of the four sp3 hybrid orbitals. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Application In Synthesis of (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin was written by Greco, Francesca;Musumeci, Domenica;Borbone, Nicola;Falanga, Andrea Patrizia;D’Errico, Stefano;Terracciano, Monica;Piccialli, Ilaria;Roviello, Giovanni Nicola;Oliviero, Giorgia. And the article was included in Molecules in 2022.Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol The following contents are mentioned in the article:

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and mol. docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico mol. docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the exptl. CD profiles of Pu22 G4 with the corresponding theor. output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the exptl. CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the pos. band, suggesting the utility of this predictive tool for G4 DNA CD investigations. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. A multistep synthesis may use Grignard-like reactions to form an alcohol with the desired carbon structure, followed by reactions to convert the hydroxyl group of the alcohol to the desired functionality.Name: (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

The structural assembly switch of cell division protein FtsZ probed with fluorescent allosteric inhibitors was written by Artola, Marta;Ruiz-Avila, Laura B.;Ramirez-Aportela, Erney;Martinez, R. Fernando;Araujo-Bazan, Lidia;Vazquez-Villa, Henar;Martin-Fontecha, Mar;Oliva, Maria A.;Martin-Galiano, A. Javier;Chacon, Pablo;Lopez-Rodriguez, Maria L.;Andreu, Jose M.;Huecas, Sonia. And the article was included in Chemical Science in 2017.Name: 3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde hydrochloride The following contents are mentioned in the article:

FtsZ is a widely conserved tubulin-like GTPase that directs bacterial cell division and a new target for antibiotic discovery. This protein assembly machine cooperatively polymerizes forming single-stranded filaments, by means of self-switching between inactive and actively associating monomer conformations. The structural switch mechanism was proposed to involve a movement of the C-terminal and N-terminal FtsZ domains, opening a cleft between them, allosterically coupled to the formation of a tight association interface between consecutive subunits along the filament. The effective antibacterial benzamide PC190723 binds into the open interdomain cleft and stabilizes FtsZ filaments, thus impairing correct formation of the FtsZ ring for cell division. We have designed fluorescent analogs of PC190723 to probe the FtsZ structural assembly switch. Among them, nitrobenzoxadiazole probes specifically bind to assembled FtsZ rather than to monomers. Probes with several spacer lengths between the fluorophore and benzamide moieties suggest a binding site extension along the interdomain cleft. These probes label FtsZ rings of live Bacillus subtilis and Staphylococcus aureus, without apparently modifying normal cell morphol. and growth, but at high concentrations they induce impaired bacterial division phenotypes typical of benzamide antibacterials. During the FtsZ assembly-disassembly process, the fluorescence anisotropy of the probes changes upon binding and dissociating from FtsZ, thus reporting open and closed FtsZ interdomain clefts. Our results demonstrate the structural mechanism of the FtsZ assembly switch, and suggest that the probes bind into the open clefts in cellular FtsZ polymers preferably to unassembled FtsZ in the bacterial cytosol. This study involved multiple reactions and reactants, such as 3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde hydrochloride (cas: 65-22-5Name: 3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde hydrochloride).

3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde hydrochloride (cas: 65-22-5) belongs to alcohols. Under appropriate conditions, inorganic acids also react with alcohols to form esters. To form these esters, a wide variety of specialized reagents and conditions can be used. Alcohols may be oxidized to give ketones, aldehydes, and carboxylic acids. These functional groups are useful for further reactions. Oxidation of organic compounds generally increases the number of bonds from carbon to oxygen (or another electronegative element, such as a halogen), and it may decrease the number of bonds to hydrogen.Name: 3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde hydrochloride

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Development and application of two inducible expression systems for Streptococcus suis was written by Zhang, Liangsheng;Zou, Wenjin;Ni, Minghui;Hu, Qiao;Zhao, Lelin;Liao, Xia;Huang, Qi;Zhou, Rui. And the article was included in Microbiology Spectrum in 2022.COA of Formula: C9H18O5S The following contents are mentioned in the article:

Streptococcus suis is an important zoonotic bacterial pathogen posing a threat to the pig industry as well as public health, for which the mechanisms of growth and cell division remain largely unknown. Developing convenient genetic tools that can achieve strictly controlled gene expression is of great value for investigating these fundamental physiol. processes of S. suis. In this study, we first identified three strong constitutive promoters, Pg, Pt, and Pe, in S. suis. Promoter Pg was used to drive the expression of repressor genes tetR and lacI, and the operator sequences were added within promoters Pt and Pe. By optimizing the insertion sites of the operator sequence, we successfully constructed an anhydrotetracycline (ATc)-inducible expression system and an isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible expression system in S. suis. We showed that these two systems provided inducer-concentration- and induction-time-dependent expression of the reporter gene. By using these tools, we investigated the subcellular localization of a key cell division protein, FtsZ, which showed that it could be correctly localized to the midcell region. In addition, we constructed a conditional knockout strain for the glmS gene, which is an essential gene, and showed that our ATc-inducible promoter could provide strictly controlled expression of glmS in trans, suggesting that our inducible expression systems can be used for deletion of essential genes in S. suis. Therefore, for the first time we developed two inducible expression systems in S. suis and showed their applications in the study of an important cell division protein and an essential gene. These genetic tools will further facilitate the functional study of other important genes of S. suis. This study involved multiple reactions and reactants, such as (2R,3R,4S,5R,6S)-2-(Hydroxymethyl)-6-(isopropylthio)tetrahydro-2H-pyran-3,4,5-triol (cas: 367-93-1COA of Formula: C9H18O5S).

(2R,3R,4S,5R,6S)-2-(Hydroxymethyl)-6-(isopropylthio)tetrahydro-2H-pyran-3,4,5-triol (cas: 367-93-1) belongs to alcohols. Because alcohols are easily synthesized and easily transformed into other compounds, they serve as important intermediates in organic synthesis. Under carefully controlled conditions, simple alcohols can undergo intermolecular dehydration to give ethers. This reaction is effective only with methanol, ethanol, and other simple primary alcohols.COA of Formula: C9H18O5S

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Topographical and mechanical properties of liposome surfaces harboring Na,K-ATPase by means of atomic force microscopy was written by Sebinelli, H. G.;Borin, I. A.;Ciancaglini, P.;Bolean, M.. And the article was included in Soft Matter in 2019.Reference of 923-61-5 The following contents are mentioned in the article:

In this study, we obtained unprecedented AFM images of the Na,K-ATPase (NKA) pump after being reconstituted into DPPC and DPPC:DPPE liposomes. The mech. properties observed in the phase images were associated with protrusions correlated to NKA microdomains, which are the darker areas seen in the AFM phase images. Protrusions in the DPPC-NKA proteoliposomes ranged from 38 to 115 nm, with 74 ± 21 nm diameter and 2.1 ± 1.4 nm height. DPPC:DPPE-NKA proteoliposomes showed protrusions from 21 to 78 nm, with 38 ± 16 nm diameter and 0.7 ± 0.5 nm height. We have estimated the presence of annular lipids in the microdomains considering that the areas of the protrusions should contain αβ oligomers and annular phospholipids. For DPPC-NKA proteoliposomes, we hypothesize that 40 phospholipids surround an (αβ)₂ dimer and 46 phospholipids are present for the DPPC:DPPE-NKA proteoliposomes in an αβ monomer. Catalytic activity measurements of both lipid compositions of proteoliposomes harboring NKA provide strong evidence regarding the protein orientation in the biomembrane. AFM data suggest that DPPC-NKA proteoliposomes are also rightside-out protein orientated, where the protrusions have an average height of 2.1 nm, while for DPPC:DPPE-NKA proteoliposomes, the majority of the protein reconstituted should be inside-out orientated, where the protrusions′ average height is 0.5 nm. This result corroborates with the enzymic anal., where 61% and 91% of the enzymic activity was recovered, resp. Thus, a new application of AFM as a tool for the determination of topol. features of protrusions in proteoliposomes has been brought to the scientific community, in addition to revealing the distinct catalytic orientation of enzymes present in the biomembranes model. This study involved multiple reactions and reactants, such as (2R)-3-(((2-Aminoethoxy)(hydroxy)phosphoryl)oxy)propane-1,2-diyl dipalmitate (cas: 923-61-5Reference of 923-61-5).

(2R)-3-(((2-Aminoethoxy)(hydroxy)phosphoryl)oxy)propane-1,2-diyl dipalmitate (cas: 923-61-5) belongs to alcohols. Because alcohols are easily synthesized and easily transformed into other compounds, they serve as important intermediates in organic synthesis. Secondary alcohols are easily oxidized without breaking carbon-carbon bonds only as far as the ketone stage. No further oxidation is seen except under very stringent conditions.Reference of 923-61-5

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Comprehensive metabolite profiling of Phoenix rupicola pulp and seeds using UPLC-ESI-MS/MS and evaluation of their estrogenic activity in ovariectomized rat model was written by M. AbouZeid, Enaam;H. Afifi, Ahmed;Salama, Abeer;A. Hussein, Rehab;S. Youssef, Fadia;El-Ahmady, Sherweit H.;Mohamed Ammar, Nagwa. And the article was included in Food Research International in 2022.Reference of 29106-49-8 The following contents are mentioned in the article:

Dates have been consumed since ancient times as functional foods which beside their high nutritional value possess various biol. activities. Phoenix rupicola T. Anderson (Cliff date palm) produces non-conventional edible dates, however, due to low natural abundance, these dates arent com. important as the dates of Phoenix dactylifera L. The present study was designed to evaluate the phytochem. constituents as well as the estrogenic activity of P. rupicola dates. UPLC-ESI-MS/MS approach was used to study the metabolite profile of the 70% aqueous methanol extracts of P. rupicola dates (pulps and seeds) for the first time. A total of fifty-five metabolites were tentatively identified in both extracts, belonging to different classes, chiefly phenolic compounds viz. procyanidins, flavonoid glycosides, hydroxycinnamic acid derivatives, as well as, fatty acids, organic acids and sphingolipids. Acute toxicity studies revealed that the studied extracts were safe at oral doses up to 2 g/kg. Besides, they possessed significant (P < 0.05) estrogenic activity in ovariectomized rat model, as compared to ovariectomized (OVX) and reference standard (17β-estradiol; OVX-E) groups. Moreover, the extracts showed significant improvement on bone metabolism, lipid profile, liver and kidney functions. In silico docking study revealed that various metabolites possessed high binding affinities to both ERs, where 2-palmitoyl glycerol (-10.28 Kcal/mol) and aminotetradecanetriol (-9.61 Kcal/mol) showed the strongest affinities to Erα and Erβ, resp. Thus, it can be concluded that P. rupicola pulp and seeds possess bioactive phytoconstituents comparable to those in P. dactylifera and can be used as a safe and efficient natural estrogen substitute in postmenopausal women. This study involved multiple reactions and reactants, such as (2R,2’R,3R,3’R,4R)-2,2′-Bis(3,4-dihydroxyphenyl)-[4,8′-bichromane]-3,3′,5,5′,7,7′-hexaol (cas: 29106-49-8Reference of 29106-49-8).

(2R,2’R,3R,3’R,4R)-2,2′-Bis(3,4-dihydroxyphenyl)-[4,8′-bichromane]-3,3′,5,5′,7,7′-hexaol (cas: 29106-49-8) belongs to alcohols. The oxygen atom of the strongly polarized O―H bond of an alcohol pulls electron density away from the hydrogen atom. This polarized hydrogen, which bears a partial positive charge, can form a hydrogen bond with a pair of nonbonding electrons on another oxygen atom. Alcohols may be oxidized to give ketones, aldehydes, and carboxylic acids. These functional groups are useful for further reactions. Oxidation of organic compounds generally increases the number of bonds from carbon to oxygen (or another electronegative element, such as a halogen), and it may decrease the number of bonds to hydrogen.Reference of 29106-49-8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

The Composition of Reconstituted High-Density Lipoproteins (rHDL) Dictates the Degree of rHDL Cargo- and Size-Remodeling via Direct Interactions with Endogenous Lipoproteins was written by Pedersbaek, Dennis;Kraemer, Martin Kisha;Kempen, Paul Joseph;Ashley, Jon;Braesch-Andersen, Sten;Andresen, Thomas L.;Simonsen, Jens B.. And the article was included in Bioconjugate Chemistry in 2019.Application of 923-61-5 The following contents are mentioned in the article:

The application of reconstituted high-d. lipoproteins (rHDL) as a drug-carrier has during the last decade been established as a promising approach for effective receptor-mediated drug delivery, and its ability to target tumors has recently been confirmed in a clin. trial. The rHDL mimics the endogenous HDL, which is known to be highly dynamic and undergo extensive enzyme-mediated remodulations. Hence, to reveal the physiol. rHDL stability, a thorough characterization of the dynamics of rHDL in biol. relevant environments is needed. The authors employ a size-exclusion chromatog. (SEC) method to evaluate the dynamics of discoidal rHDL in fetal bovine serum (FBS), where the authors track both the rHDL lipids (by the fluorescence from lipid-conjugated fluorophores) and apoA-I (by human apoA-I ELISA). The authors show by using lipoprotein depleted FBS and isolated lipoproteins that rHDL lipids can be transferred to endogenous lipoproteins via direct interactions in a nonenzymic process, resulting in rHDL compositional- and size-remodeling. This type of dynamics could lead to misinterpretations of fluorescence-based rHDL uptake studies due to desorption of labile lipophilic fluorophores or off-target side-effects due to desorption of incorporated drugs. Importantly, the authors show how the degree of rHDL remodeling can be controlled by the compositional design of the rHDL. Understanding the correlation between the mol. properties of the rHDL constituents and their collective dynamics is essential for improving the rHDL-based drug delivery platform. Taken together, the work highlights the need to carefully consider the compositional design of rHDL and test its stability in a biol. relevant environment, when developing rHDL for drug delivery purposes. This study involved multiple reactions and reactants, such as (2R)-3-(((2-Aminoethoxy)(hydroxy)phosphoryl)oxy)propane-1,2-diyl dipalmitate (cas: 923-61-5Application of 923-61-5).

(2R)-3-(((2-Aminoethoxy)(hydroxy)phosphoryl)oxy)propane-1,2-diyl dipalmitate (cas: 923-61-5) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. Grignard and organolithium reagents are powerful tools for organic synthesis, and the most common products of their reactions are alcohols.Application of 923-61-5

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

[Preparation and characterization of a recombinant poly-epitopic vaccine EgG1Y162-2 (4) against cystic echinococcosis based on the linker GSGGSG]. was written by Zheng, J;Zhang, D J;Zhao, S Q;Li, Y M;Zhou, Y X;Zhou, W T;Zhou, X T. And the article was included in Chinese journal of schistosomiasis control in 2022.HPLC of Formula: 367-93-1 The following contents are mentioned in the article:

OBJECTIVE: To perform prokaryotic expression and preliminary characterization of the recombinant poly-epitope vaccine EgG1Y162-2 (4) against cystic echinococcosis. METHODS: The recombinant poly-epitope vaccine EgG1Y162-2 (4) against Echinococcus granulosus based on the linker GSGGSG was subjected to structural three-dimensional (3D) modeling using immunoinformatics to analyze the structural changes and evaluate the antigenicity of the vaccine. The pET30a-EgG1Y162-2 (4) recombinant plasmid was generated using double digestion with EcoR I and Sal I, and then transformed into competent cells. Following protein induction with isopropyl-β-D-thiogalactoside (IPTG), the prokaryotic expression proteins were characterized using Western blotting, and the antigenicity of the recombinant protein was analyzed using sera from cystic echinococcosis patients and health volunteers. RESULTS: The four EgG1Y162-2 proteins coupled by the 3D structure of the recombinant vaccine EgG1Y162-2 (4) presented independent and effective expression and good antigenicity. The highest protein expression was detected in the supernatant following induction of the recombinant plasmid pET30a-EgG1Y162-2 (4) by 0.2 mmol/L IPTG at 37 °C for 4 h, and a pure protein component was seen following elution with 60 mmol/L imidazole. Western blotting analysis of the recombinant multiepitope protein HIS-EgG1Y162-2 (4) showed a band at approximately 39 kDa, and this band was recognized by sera from cystic echinococcosis patients. CONCLUSIONS: A recombinant poly-epitope vaccine EgG1Y162-2 (4) against cystic echinococcosis has been successfully constructed, which provides a preliminary basis for researches on recombinant multi-epitope vaccine against cystic echinococcosis. This study involved multiple reactions and reactants, such as (2R,3R,4S,5R,6S)-2-(Hydroxymethyl)-6-(isopropylthio)tetrahydro-2H-pyran-3,4,5-triol (cas: 367-93-1HPLC of Formula: 367-93-1).

(2R,3R,4S,5R,6S)-2-(Hydroxymethyl)-6-(isopropylthio)tetrahydro-2H-pyran-3,4,5-triol (cas: 367-93-1) belongs to alcohols. A strong base can deprotonate an alcohol to yield an alkoxide ion (R―O−). For example, sodamide (NaNH2), a very strong base, abstracts the hydrogen atom of an alcohol. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.HPLC of Formula: 367-93-1

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Phytochemical Contents of Different Parts of the Seeded Raisins from the South-East Anatolia: Enzyme Inhibitory Potential of Pulp Extracts was written by Karatas, Dilek Degirmenci;Oz, Veysi;Yener, Ismail;Akdeniz, Mehmet;Erek, Figen;Aydin, Isil;Yigitkan, Serkan;Yilmaz, Mustafa Abdullah;Ertas, Abdulselam. And the article was included in Chemistry & Biodiversity in 2022.Computed Properties of C20H22O8 The following contents are mentioned in the article:

In this study, some phytochem. properties of six seeded raisin species that are mainly cultivated in Southeastern Anatolia were investigated. Addnl., some phys. and quality characteristics, phenolic contents (by LC-MS/MS; Liquid Chromatog. Tandem Mass/Mass Spectrometer System), anticholinesterase, and antioxidant capacities (DPPH; 2,2-diphenyl-1-picrylhydrazyl) free-radical scavenging, ABTS; 2,2-azinobis(3-ethylbenzothiazoline-6-sulfonic acid cation-radical scavenging activity and CUPRAC; cupric reducing antioxidant capacity) of the cultivars were investigated on ground raisins. In all three methods, the antioxidant activity values of seed extracts were determined to be higher than those of leaf and pulp extracts Remarkably, the seed extract of Banazi Siyahi showed the highest antioxidant activity in ABTS (IC50: 4.35±0.02μg/mL), DPPH (IC50: 10.78±0.78μg/mL), and CUPRAC (A0.5: 9.33±0.45μg/mL) methods. Addnl., the ethanol extracts of all pulp samples showed higher anticholinesterase activity against acetyl-(AChE) and butyrylcholinesterase (BChE) enzymes than galantamine. According to the LC-MS/MS results, catechin (21.362 mg analyte/g extract) and epicatechin (44.667 mg analyte/g extract) found to be quite rich in Kerkues seed extract and isoquercitrin (116.873 mg analyte/g extract) and astragalin (31.915 mg analyte/g extract) detected to be quite rich in Banazi Siyahi leaf extract Considering the mineral content of the varieties and the soil samples they grow in, all of the grape varieties analyzed in the study was found to be rich. Based on these findings, it might be suggested that Banazi Siyahi and Kerkues varieties have potential to be utilized in pharmaceutical and food industries, due to their contents of catechins, isoquercitrin and astragalin. This study involved multiple reactions and reactants, such as (2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6Computed Properties of C20H22O8).

(2S,3R,4S,5S,6R)-2-(3-Hydroxy-5-((E)-4-hydroxystyryl)phenoxy)-6-(hydroxymethyl)tetrahydro-2H-pyran-3,4,5-triol (cas: 27208-80-6) belongs to alcohols. Alcohols are among the most common organic compounds. They are used as sweeteners and in making perfumes, are valuable intermediates in the synthesis of other compounds, and are among the most abundantly produced organic chemicals in industry. Converting an alcohol to an alkene requires removal of the hydroxyl group and a hydrogen atom on the neighbouring carbon atom. Dehydrations are most commonly carried out by warming the alcohol in the presence of a strong dehydrating acid, such as concentrated sulfuric acid.Computed Properties of C20H22O8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts

Calculation of the isobaric heat capacities of the liquid and solid phase of organic compounds at and around 298.15 K based on their “true” molecular volume was written by Naef, Rudolf. And the article was included in Molecules in 2019.Product Details of 106-21-8 The following contents are mentioned in the article:

A universally applicable method for the prediction of the isobaric heat capacities of the liquid and solid phase of mols. at 298.15 K is presented, derived from their “true” volume The mols.’ “true” volume in A3 is calculated on the basis of their geometry-optimized structure and the Van-der-Waals radii of their constituting atoms by means of a fast numerical algorithm. Good linear correlations of the “true” volume of a large number of compounds encompassing all classes and sizes with their exptl. liquid and solid heat capacities over a large range have been found, although noticeably distorted by intermol. hydrogen-bond effects. To account for these effects, the total amount of 1303 compounds with known exptl. liquid heat capacities has been subdivided into three subsets consisting of 1102 hydroxy-group-free compounds, 164 monoalcs./monoacids, and 36 polyalcs./polyacids. The standard deviations for Cp(liq,298) were 20.7 J/mol/K for the OH-free compunds, 22.91 J/mol/K for the monoalcs./monoacids and 16.03 J/mol/K for the polyols/polyacids. Analogously, 797 compounds with known solid heat capacities have been separated into a subset of 555 OH-free compounds, 123 monoalcs./monoacids and 119 polyols/polyacids. The standard deviations for Cp(sol,298) were calculated to 23.14 J/mol/K for the first, 21.62 J/mol/K for the second, and 19.75 J/mol/K for the last subset. A discussion of structural and intermol. effects influencing the heat capacities as well as of some special classes, in particular hydrocarbons, ionic liquids, siloxanes and metallocenes, has been given. In addition, the present method has successfully been extended to enable the prediction of the temperature dependence of the solid and liquid heat capacities in the range between 250 and 350 K. This study involved multiple reactions and reactants, such as 3,7-Dimethyloctan-1-ol (cas: 106-21-8Product Details of 106-21-8).

3,7-Dimethyloctan-1-ol (cas: 106-21-8) belongs to alcohols. Because alcohols are easily synthesized and easily transformed into other compounds, they serve as important intermediates in organic synthesis. Grignard and organolithium reagents are powerful tools for organic synthesis, and the most common products of their reactions are alcohols.Product Details of 106-21-8

Referemce:
Alcohol – Wikipedia,
Alcohols – Chemistry LibreTexts